View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1685-Insertion-1 (Length: 223)
Name: NF1685-Insertion-1
Description: NF1685
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1685-Insertion-1 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 7 - 223
Target Start/End: Complemental strand, 33355547 - 33355329
Alignment:
| Q |
7 |
acacactctcttttttgtttccatcagttatgcatttaatgaaacagttcatcaacnnnnnnncacattctaatacttactagaaaaatccattggatca |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
33355547 |
acacactctcttttttgtttccatcagttatgcatttaatgaaacagttcatcaactttttttcacattataatacttactagcaaaatccattggatca |
33355448 |
T |
|
| Q |
107 |
tgttagttagcttaaatgttatgtagcattgat--attacatattaaagatgtgtctgatgtcaaacatgtgtaggcgctcaacaccaacatgatacaaa |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||| | |||||||||||| |
|
|
| T |
33355447 |
tgttagttagcttaaatgttatgtagcattgatctattacatattaaagatgtgtctgatgtcaaacatgtgtaggcgttcaacatccacatgatacaaa |
33355348 |
T |
|
| Q |
205 |
cacatgtagttacttttaa |
223 |
Q |
| |
|
||||||||||||| ||||| |
|
|
| T |
33355347 |
cacatgtagttacatttaa |
33355329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University