View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1685-Insertion-4 (Length: 111)
Name: NF1685-Insertion-4
Description: NF1685
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1685-Insertion-4 |
 | |
|
| [»] chr6 (2 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 68; Significance: 7e-31; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 68; E-Value: 7e-31
Query Start/End: Original strand, 16 - 111
Target Start/End: Original strand, 11712518 - 11712612
Alignment:
| Q |
16 |
aacagtataataataaaataaacaaaacaagtttcacaaatcatagatatggaaggtgaaatgaatatgaataataataataggtaggatgtttgt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||| | ||| |||||||||||||||||||| |
|
|
| T |
11712518 |
aacagtataataataaaataaacaaaacaagtttcacaaatcatggatatggaacgtgaaatgaatat-atgaatgataataggtaggatgtttgt |
11712612 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 59; E-Value: 2e-25
Query Start/End: Original strand, 17 - 111
Target Start/End: Original strand, 12063895 - 12063992
Alignment:
| Q |
17 |
acagtataataataaaataaacaaaacaagttt--cacaaatcatagatatggaaggtgaaatgaatatgaataata-ataataggtaggatgtttgt |
111 |
Q |
| |
|
||||||||||||||||| |||||| |||||||| |||||||||||||||||||| ||||||||||||| ||| ||| |||||||||||||||||||| |
|
|
| T |
12063895 |
acagtataataataaaacaaacaatacaagtttttcacaaatcatagatatggaacgtgaaatgaatatcaatgatatataataggtaggatgtttgt |
12063992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University