View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16851_high_7 (Length: 205)
Name: NF16851_high_7
Description: NF16851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16851_high_7 |
 | |
|
| [»] scaffold0537 (1 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 62; Significance: 5e-27; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 62; E-Value: 5e-27
Query Start/End: Original strand, 119 - 196
Target Start/End: Original strand, 5885747 - 5885824
Alignment:
| Q |
119 |
gtagtgtgtgggggatttattgttgttcgtattttgcagctgtgtttttgctactggatttgctgttgctgatgatgt |
196 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| |||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
5885747 |
gtagtgtttgggggatttattgttgttcgtattttgcagctatgttgttgctactggatttgttgttgctgatgatgt |
5885824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 62; Significance: 5e-27; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 62; E-Value: 5e-27
Query Start/End: Original strand, 119 - 196
Target Start/End: Complemental strand, 51510942 - 51510865
Alignment:
| Q |
119 |
gtagtgtgtgggggatttattgttgttcgtattttgcagctgtgtttttgctactggatttgctgttgctgatgatgt |
196 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||| ||||||||| || |||||||||||||||||| |
|
|
| T |
51510942 |
gtagtgtttgggggatttattgttgttcgtattttgcagctgtgttgttgctactgaatatgctgttgctgatgatgt |
51510865 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 58; Significance: 1e-24; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 119 - 196
Target Start/End: Complemental strand, 27708202 - 27708125
Alignment:
| Q |
119 |
gtagtgtgtgggggatttattgttgttcgtattttgcagctgtgtttttgctactggatttgctgttgctgatgatgt |
196 |
Q |
| |
|
||||||| |||| |||||||||||||| ||||||||||| |||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
27708202 |
gtagtgtttgggtgatttattgttgtttgtattttgcagttgtgttgttgctactggatttgctgttgctgatgatgt |
27708125 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 55; Significance: 8e-23; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 119 - 189
Target Start/End: Complemental strand, 17384532 - 17384462
Alignment:
| Q |
119 |
gtagtgtgtgggggatttattgttgttcgtattttgcagctgtgtttttgctactggatttgctgttgctg |
189 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
17384532 |
gtagtgtttgggggatttattgttgtttgtattttgcagttgtgttgttgctactggatttgctgttgctg |
17384462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0537 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: scaffold0537
Description:
Target: scaffold0537; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 119 - 196
Target Start/End: Original strand, 10611 - 10693
Alignment:
| Q |
119 |
gtagtgtgtgggggatttattgttgttcgtattttgcagc-----tgtgtttttgctactggatttgctgttgctgatgatgt |
196 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| |||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
10611 |
gtagtgtttgggggatttattgttgttcgtattttgcagctatgatgtgttgttgctactggatttgttgttgctgatgatgt |
10693 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University