View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16851_low_9 (Length: 225)
Name: NF16851_low_9
Description: NF16851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16851_low_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 1016519 - 1016314
Alignment:
| Q |
1 |
tatgagacaatgacaaagagctaccacaaggcacccgccgcatttgctgtccttggtgttggtttggttgttgtctgtgatggagagaatgaaactgggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1016519 |
tatgagacaatgacaaagagctaccataaggcacccgccgcatttgctgtccttggtgttggtttggttgttgtctgtgatggagagaatgaaactgggt |
1016420 |
T |
|
| Q |
101 |
ggcggtggtgatgctgaaggggccatgttgatgtgttggatctaacaacaatgttgttgatagaacgttggagattgaggttttggttttggttcagtgt |
200 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1016419 |
ggcggtgatgatgttgaaggggccatgttgatgtgttgaatctaacaacaatgttgttgatagaacgttggagattgaggttttggttttggttctgtgt |
1016320 |
T |
|
| Q |
201 |
attaaa |
206 |
Q |
| |
|
| |||| |
|
|
| T |
1016319 |
actaaa |
1016314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 64; Significance: 4e-28; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 119 - 194
Target Start/End: Complemental strand, 5175729 - 5175654
Alignment:
| Q |
119 |
ggggccatgttgatgtgttggatctaacaacaatgttgttgatagaacgttggagattgaggttttggttttggtt |
194 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
5175729 |
ggggccatgttgatgtgttgaatctaacaacaacgttgttgatagaatgttggagattgaggttttggttttggtt |
5175654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 4 - 53
Target Start/End: Complemental strand, 5175826 - 5175777
Alignment:
| Q |
4 |
gagacaatgacaaagagctaccacaaggcacccgccgcatttgctgtcct |
53 |
Q |
| |
|
||||||| |||||||||||||||| ||| | ||||| ||||||||||||| |
|
|
| T |
5175826 |
gagacaaggacaaagagctaccactaggtaaccgccacatttgctgtcct |
5175777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University