View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16853_high_24 (Length: 241)
Name: NF16853_high_24
Description: NF16853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16853_high_24 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 67; Significance: 7e-30; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 112 - 194
Target Start/End: Complemental strand, 27986063 - 27985981
Alignment:
| Q |
112 |
aaaaggaactggggcaagatcttctagaatttgaagttcgaacttccactgcatattcccaaacactgcacaagagaagtttg |
194 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |||||||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
27986063 |
aaaaggaactagggcaagatcttctagaatttgaaattcgaacttccactacacattcccaaacactgcacaagagaagtttg |
27985981 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 188 - 235
Target Start/End: Complemental strand, 27985949 - 27985902
Alignment:
| Q |
188 |
aagtttgtgtgagacatgagaatgacaatatatccaccagcaccacct |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
27985949 |
aagtttgtgtgagacatgagaatgacaatatatacaccagcaccacct |
27985902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University