View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16853_low_11 (Length: 406)
Name: NF16853_low_11
Description: NF16853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16853_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 363; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 363; E-Value: 0
Query Start/End: Original strand, 12 - 390
Target Start/End: Original strand, 44489687 - 44490065
Alignment:
| Q |
12 |
atcatcaacttgggaggtgtagagagtttcattagtatttttgagtgcaacataattggattttgataagtattgggaggtgagttgggagagaaataaa |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
44489687 |
atcatcaacttgggaggtgtagagagtttcattagtatttttgagtgcaacataattggattttgataagtattgtgaggtgagttgggagagaaataaa |
44489786 |
T |
 |
| Q |
112 |
caatctttgagagcatttattgcctctttggtaaaagtagactcaagatagaagttcaatgagttcaaaaacttttgggactgaaacatggatttttgaa |
211 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
44489787 |
caatctttgagagcatttattgtctctttggtaaaagtagactcaagatagaagttcaatgagttcaaaaatttttgggactgaaacatggatttttgaa |
44489886 |
T |
 |
| Q |
212 |
ttgagaatctagcaaagtcatggactttggcattttgttttggaagtagatttgtgcaataagatggatattgggatgatttacaaatggtttctggagg |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44489887 |
ttgagaatctagcaaagtcatggactttggcattttgttttggaagtagatttgtgcaataagatggatattgggatgatttacaaatggtttctggagg |
44489986 |
T |
 |
| Q |
312 |
tacaagagtgtcatttgcggtagctagaaatgcaaagaatggaaggagaaagaaaattgagaatgtagtagcaatagag |
390 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44489987 |
tacaagggtgtcatttgcggtagctagaaatgcaaagaatggaaggagaaagaaaattgagaatgtagtagcaatagag |
44490065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University