View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16853_low_28 (Length: 281)
Name: NF16853_low_28
Description: NF16853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16853_low_28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 56; Significance: 3e-23; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 18 - 73
Target Start/End: Complemental strand, 11202594 - 11202539
Alignment:
| Q |
18 |
tgaacgacggttgtgggtttgttcgacggcgagtgtgagaggcagtgagtgtgaga |
73 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11202594 |
tgaacgacggttgtgggtttgttcgacggcgagtgtgagaggcagtgagtgtgaga |
11202539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 183 - 265
Target Start/End: Complemental strand, 11202390 - 11202306
Alignment:
| Q |
183 |
aaaagtttagaggaaagaaaatgacagtgaaaaacaaaatgga--ttatatatacccttgtaatctgagcttcttcttattttta |
265 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||||||| ||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
11202390 |
aaaagattagaggaaagaaaatgacagggaaaaacaaaatggagtatatatatacacttgtaatttgagcttcttcttattttta |
11202306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 90 - 160
Target Start/End: Complemental strand, 11202498 - 11202428
Alignment:
| Q |
90 |
aagaagctctaagttcatacagctctgctccggcttagaacgg-ccccgcaaatgaacggtgagattgatcc |
160 |
Q |
| |
|
||||||||||||||||||| |||| ||||| |||||||||||| ||||| ||||| ||||||||||||||| |
|
|
| T |
11202498 |
aagaagctctaagttcatatagctttgctctggcttagaacggaccccgtaaatg-gcggtgagattgatcc |
11202428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 18 - 58
Target Start/End: Complemental strand, 51741880 - 51741840
Alignment:
| Q |
18 |
tgaacgacggttgtgggtttgttcgacggcgagtgtgagag |
58 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
51741880 |
tgaacgacggttatgggtttgttcgacggcgagtgtgagag |
51741840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University