View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16853_low_40 (Length: 238)
Name: NF16853_low_40
Description: NF16853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16853_low_40 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 17 - 225
Target Start/End: Complemental strand, 4891637 - 4891434
Alignment:
| Q |
17 |
caaagagaacaatccatttctgacagctgtatccataaccaggataattgattaggttttcaattttgcgtgctctcggtccatctcgctagggtttttg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4891637 |
caaagagaacaatccatttctgacagctgtatccataaccaggataattgattaggttttcaattttgcgt-----cggtccatctcgctagggtttttg |
4891543 |
T |
|
| Q |
117 |
attctgcgagatggcaagttcttcatcttctagttggcgagaaggaatgtcctctgataatatcaaaggtttagttctcgctcttccatccagtttcttc |
216 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4891542 |
attccgcgagatggcaagttcttcatcttctagttggcgagaaggaatgtcctctgataatatcaaaggtttagttctcgctcttccatccagtttcttc |
4891443 |
T |
|
| Q |
217 |
atctgtgct |
225 |
Q |
| |
|
||| ||||| |
|
|
| T |
4891442 |
atcggtgct |
4891434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 90 - 219
Target Start/End: Original strand, 440183 - 440312
Alignment:
| Q |
90 |
tctcggtccatctcgctagggtttttgattctgcgagatggcaagttcttcatcttctagttggcgagaaggaatgtcctctgataatatcaaaggttta |
189 |
Q |
| |
|
||||| ||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
440183 |
tctcgatccatctcgctagggtttttgattccgcgagatggcgagttcttcatcttctagttggcgagagggaatgtcctctgataatatcaaaggttta |
440282 |
T |
|
| Q |
190 |
gttctcgctcttccatccagtttcttcatc |
219 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |
|
|
| T |
440283 |
gttctcgctctttcatccagtttcttcatc |
440312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University