View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16853_low_44 (Length: 213)
Name: NF16853_low_44
Description: NF16853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16853_low_44 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 65; Significance: 9e-29; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 1 - 65
Target Start/End: Original strand, 25264995 - 25265059
Alignment:
| Q |
1 |
aatgggtaaaagaaataatcttgatctcaaggatatgaaatgggtgtgtgttgtagtgactgaca |
65 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25264995 |
aatgggtaaaagaaataatcttgatctcaaggatatgaaatgggtgtgtgttgtagtgactgaca |
25265059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 36 - 91
Target Start/End: Complemental strand, 25264984 - 25264929
Alignment:
| Q |
36 |
tgaaatgggtgtgtgttgtagtgactgacagaaggggtaaaagaaacaatcttgat |
91 |
Q |
| |
|
||||||||||||||||||||||||||| | |||| |||| |||||||||||||||| |
|
|
| T |
25264984 |
tgaaatgggtgtgtgttgtagtgactggcggaagaggtagaagaaacaatcttgat |
25264929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University