View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16853_low_45 (Length: 209)
Name: NF16853_low_45
Description: NF16853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16853_low_45 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 127; Significance: 9e-66; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 18 - 187
Target Start/End: Original strand, 4570525 - 4570692
Alignment:
| Q |
18 |
gaagacctaaaccacccaactctttaagcttaacgactttgtcccacccaacagcatgatattttctctcattattcatctccccccaaatgaatttgcg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4570525 |
gaagacctaaaccacccaactctttaagcttaacgactttgtcccacccaactgcatgatattttctctcattattcatctccccccaaatgaatttgcg |
4570624 |
T |
|
| Q |
118 |
ttgtatccttt---gaatttcatcaacacaagatttgggaatggaatgattgaagtgatcattggatatatat |
187 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| | |||||||||||||| |||||||||||||||| |
|
|
| T |
4570625 |
ttgtatcctttgaagaatttcatcaacacaagattcg-----ggaatgattgaagtcatcattggatatatat |
4570692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University