View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16855_high_2 (Length: 382)
Name: NF16855_high_2
Description: NF16855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16855_high_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 349; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 349; E-Value: 0
Query Start/End: Original strand, 19 - 371
Target Start/End: Original strand, 42445346 - 42445698
Alignment:
| Q |
19 |
aatggagccccatggatgctcacagttggagcaagcactattgacagaaccattgtggcaacagcagtgcttggaaatggggaagaatttgagggcgaat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42445346 |
aatggagccccatggatgctcacagttggagcaagcactattgacagaaccattgtggcaacagcagtgcttggaaatggggaagaatttgagggcgaat |
42445445 |
T |
 |
| Q |
119 |
ctgttttccagccttccgatttctctccaacactgttgcccttagcatatgcaggaataaatggcaaagtagaatcttcattttgtgctaatggatcctt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42445446 |
ctgttttccagccttccgatttctctccaacactgttgcccttagcatatgcaggaataaatggcaaagtagaatcttcattttgtgctaatggatcctt |
42445545 |
T |
 |
| Q |
219 |
gagtgacattgacttcagaggaaaggttgttttgtgtgagaggggagggggtataggaagaattgccaaaggacaggaagtacaaagagcaggtggtgcc |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42445546 |
gagtgacattgacttcagaggaaaggttgttttgtgtgagaggggagggggtataggaagaattgccaaaggacaggaagtacaaagagcaggtggtgcc |
42445645 |
T |
 |
| Q |
319 |
gccatgattctcatgaatgatgaactcaatggtttcagtctctcagatgatgt |
371 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
42445646 |
gccatgattctcatgaatgatgaactcaatggtttcagtctctcagctgatgt |
42445698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University