View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16855_high_9 (Length: 209)

Name: NF16855_high_9
Description: NF16855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16855_high_9
NF16855_high_9
[»] chr4 (6 HSPs)
chr4 (12-194)||(37347949-37348131)
chr4 (138-194)||(37290232-37290288)
chr4 (85-189)||(37315410-37315514)
chr4 (85-189)||(37326963-37327067)
chr4 (143-194)||(29476610-29476661)
chr4 (85-194)||(19554258-19554367)


Alignment Details
Target: chr4 (Bit Score: 171; Significance: 5e-92; HSPs: 6)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 12 - 194
Target Start/End: Complemental strand, 37348131 - 37347949
Alignment:
12 aggagcagagaagggaatttgtttaacttggaaggatttatgggtgactgtttctgcttcaacaggaaaaaccaatgaaagcaaatcaattcttcagggt 111  Q
    ||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37348131 aggagaagagaagggagtttgtttaacttggaaggatttatgggtgactgtttctgcttcaacaggaaaaaccaatgaaagcaaatcaattcttcagggt 37348032  T
112 ctgactggttatgcaaaaccagctcagcttttggctattatgggtccttctggttgtggaaaatctacacttcttgatgcttt 194  Q
    || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37348031 ctaactggttatgcaaaaccagctcagcttttggctattatgggtccttctggttgtggaaaatctacacttcttgatgcttt 37347949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 138 - 194
Target Start/End: Original strand, 37290232 - 37290288
Alignment:
138 gcttttggctattatgggtccttctggttgtggaaaatctacacttcttgatgcttt 194  Q
    ||||||||||||||||||||| ||||| | ||||||||| |||||||||||||||||    
37290232 gcttttggctattatgggtccatctggctctggaaaatccacacttcttgatgcttt 37290288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 85 - 189
Target Start/End: Original strand, 37315410 - 37315514
Alignment:
85 aatgaaagcaaatcaattcttcagggtctgactggttatgcaaaaccagctcagcttttggctattatgggtccttctggttgtggaaaatctacacttc 184  Q
    |||| |||||||||||||||||| ||  | ||||||||||| ||||| | ||| || ||||| || |||||||||||||| ||||| || |||||||| |    
37315410 aatggaagcaaatcaattcttcaaggattaactggttatgctaaacctggtcaactcttggccataatgggtccttctggctgtggcaagtctacactac 37315509  T
185 ttgat 189  Q
    |||||    
37315510 ttgat 37315514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 85 - 189
Target Start/End: Original strand, 37326963 - 37327067
Alignment:
85 aatgaaagcaaatcaattcttcagggtctgactggttatgcaaaaccagctcagcttttggctattatgggtccttctggttgtggaaaatctacacttc 184  Q
    |||| |||||||||||||||||| ||  | ||||||||||| ||||| | ||| || ||||| || |||||||||||||| ||||| || |||||||| |    
37326963 aatggaagcaaatcaattcttcaaggattaactggttatgctaaacctggtcaactcttggccataatgggtccttctggctgtggcaagtctacactac 37327062  T
185 ttgat 189  Q
    |||||    
37327063 ttgat 37327067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 143 - 194
Target Start/End: Original strand, 29476610 - 29476661
Alignment:
143 tggctattatgggtccttctggttgtggaaaatctacacttcttgatgcttt 194  Q
    |||||||||||||||| ||||||| |||||||||||| ||||||||||||||    
29476610 tggctattatgggtccatctggttctggaaaatctactcttcttgatgcttt 29476661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 85 - 194
Target Start/End: Complemental strand, 19554367 - 19554258
Alignment:
85 aatgaaagcaaatcaattcttcagggtctgactggttatgcaaaaccagctcagcttttggctattatgggtccttctggttgtggaaaatctacacttc 184  Q
    |||| ||||| |||||||||||| || || || |||||||  || |||| ||| |||||||| || ||||| |||||||| ||||| || |||||||| |    
19554367 aatggaagcagatcaattcttcacggactaacaggttatgttaagccaggtcaacttttggccataatgggcccttctggctgtggcaagtctacactac 19554268  T
185 ttgatgcttt 194  Q
    ||||| ||||    
19554267 ttgatacttt 19554258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University