View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16856_high_3 (Length: 237)
Name: NF16856_high_3
Description: NF16856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16856_high_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 46751600 - 46751816
Alignment:
| Q |
1 |
cttaccatcgaactgaatgctcatcgcagtctgattcactatggagtatgataatttgttggcattgagagttgtcatatacttttgctcttatatccat |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46751600 |
cttaccatcgaactgacggctcatcgcagtctgattcactatggagtgtgataatttgttggcattgagagttgtcatatacttttgctcttatatccat |
46751699 |
T |
|
| Q |
101 |
gtcttgtaatgttttgtttttgtatgaaaggaattgaattttgagaatgtagttgtatatgtttggtaaccgttttaaaaatgacttgtcttcttcccac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
46751700 |
gtcttgtaatgttttgtttttgtatgaaaggaattgaattttgagaatgtagttgtatatgtttggtaaccgttttaaaattgacttgtcttcttcccac |
46751799 |
T |
|
| Q |
201 |
cacctgctgtctttctt |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
46751800 |
cacctgctgtctttctt |
46751816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University