View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16859_low_10 (Length: 222)
Name: NF16859_low_10
Description: NF16859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16859_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 11 - 213
Target Start/End: Complemental strand, 903301 - 903091
Alignment:
| Q |
11 |
tgagaagaattgagtaattgagtgatttagtaccttggacaaagaatatctcttattcctctggccttttttcactcttaacggacacagtagggtaggg |
110 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
903301 |
tgagaagaattgggtaattgagtgctttagtaccttggacaaagaatatctcttattcctctggccttttttcactcttaacggacacactagggtaggg |
903202 |
T |
 |
| Q |
111 |
ttgtcccatttgtat--------gacaagagaaagacactacatatagagcaatattaaggtttcactattgcctatgtttaggtttatacctaagcccc |
202 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
903201 |
ttgttccatttgtatgacataatgacaagagaaagacactacatatagagcaatattaaggtttcactattgcctatgtttaggtttatacctaagcccc |
903102 |
T |
 |
| Q |
203 |
cttgatgatgt |
213 |
Q |
| |
|
||||||||||| |
|
|
| T |
903101 |
cttgatgatgt |
903091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University