View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16859_low_3 (Length: 301)
Name: NF16859_low_3
Description: NF16859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16859_low_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 9 - 175
Target Start/End: Complemental strand, 33734085 - 33733910
Alignment:
| Q |
9 |
gattattcttgtcttatgtctccagacaaataactcgctattctcctctgtagcgaatctcactgattggaaatttggaatcttaaacataaatactcca |
108 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33734085 |
gattcttcttgtcttatgtctccagacaaataactcgctattctcctctgtagcgaatctcactgattggaaatttggaatcttaaacataaatactcca |
33733986 |
T |
 |
| Q |
109 |
tcatttaggcaattgtgattgcaataa---------acacgatttcaacatttggttgtgaggatcaaccgccttt |
175 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33733985 |
tcatttaggcaattgtgattgcaataaacacaataaacacgatttcaacatttggttgtgaggatcaaccgccttt |
33733910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 168 - 281
Target Start/End: Complemental strand, 33733276 - 33733155
Alignment:
| Q |
168 |
ccgcctttcaaatcaaagagaatttgacgtagctttgaacaatctta--------aggttcatagtttatagggaaaaatacaataaccttgcttgaggt |
259 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33733276 |
ccgcctttcaaatcaatgagaatttgacgtagctttgaacaatcttacaatcttaaggttcatagtttatagggaaaaatacaataaccttgcttgaggt |
33733177 |
T |
 |
| Q |
260 |
atgctcttacgtcacaaatacc |
281 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
33733176 |
atgctcttacgtcacaaatacc |
33733155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 44; Significance: 5e-16; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 227 - 282
Target Start/End: Original strand, 8005322 - 8005377
Alignment:
| Q |
227 |
tatagggaaaaatacaataaccttgcttgaggtatgctcttacgtcacaaataccc |
282 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
8005322 |
tatagggaaaaatacaataacctcccttgaggtatgctcttatgtcacaaataccc |
8005377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University