View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1685_high_7 (Length: 254)
Name: NF1685_high_7
Description: NF1685
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1685_high_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 19 - 236
Target Start/End: Original strand, 30727267 - 30727486
Alignment:
| Q |
19 |
taaaggagataaataacggttatgactgagtgtgataaaatactatatagtaaactgtttaacttaagtttccaccaagctcatatggtatataatactg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30727267 |
taaaggagataaataacggttatgactgagtgtgataaaatactatatagtaaactgtttatcttaagtttccaccaagctcatatggtatataatactg |
30727366 |
T |
 |
| Q |
119 |
ttagtctgttactactg--tggtagtgtaacttaacttcaactatttagtatgtacctaaagtgtgtgccataatttaactcatttctattgtaccaaaa |
216 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
30727367 |
ttagtctgttactactgtctggtagtgtaacttaacttcaactatttagtatgtacctaaagtgtgtgccataatttaacacatttccattgtaccaaaa |
30727466 |
T |
 |
| Q |
217 |
acaagtgtatagcatctctg |
236 |
Q |
| |
|
||||||||||||||| |||| |
|
|
| T |
30727467 |
acaagtgtatagcatttctg |
30727486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University