View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1685_low_7 (Length: 293)
Name: NF1685_low_7
Description: NF1685
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1685_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 155; Significance: 3e-82; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 30 - 222
Target Start/End: Complemental strand, 30540418 - 30540231
Alignment:
| Q |
30 |
tattaagttgtgagattgtattagtaaaaatcatggtgcaaatagtagcatcccaagggattagtacataatagcccaacttcatgtcaggtgtgtatgt |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30540418 |
tattaagttgtgagattgtattagtaaaaatcatggtgcaaatagtagcatcccaagggattagtacataatagcccaacttcatgtcaggtgtgtatgt |
30540319 |
T |
 |
| Q |
130 |
ttgaatcagtctttgcccatttcacctaacaacatattgcatattcaggggtgtagaaccgtgtagccaacacaatgaatgtctttcttggtt |
222 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| ||||||||||||||||| ||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
30540318 |
ttgaatcagtctttgcccatttcacct---aacatatt-catattcaggggtgtaggacc-tgtagccaacccaatgaatgtctttcttggtt |
30540231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University