View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1686-Insertion-5 (Length: 72)
Name: NF1686-Insertion-5
Description: NF1686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1686-Insertion-5 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 65; Significance: 3e-29; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 65; E-Value: 3e-29
Query Start/End: Original strand, 8 - 72
Target Start/End: Original strand, 4713480 - 4713544
Alignment:
| Q |
8 |
tatgagtgatgtggttgggactttagagcttgcgttgaaattggttatgagtggggaggatggta |
72 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4713480 |
tatgagtgatgtggttgggactttagagcttgcgttgaaattggttatgagtggggaggatggta |
4713544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 54; E-Value: 1e-22
Query Start/End: Original strand, 8 - 65
Target Start/End: Original strand, 4854850 - 4854907
Alignment:
| Q |
8 |
tatgagtgatgtggttgggactttagagcttgcgttgaaattggttatgagtggggag |
65 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4854850 |
tatgagtgatgtggttggaactttagagcttgcgttgaaattggttatgagtggggag |
4854907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University