View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1686-Insertion-6 (Length: 174)
Name: NF1686-Insertion-6
Description: NF1686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1686-Insertion-6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 44; Significance: 3e-16; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 7 - 74
Target Start/End: Complemental strand, 34960626 - 34960559
Alignment:
| Q |
7 |
attataaccggaccatttcagcctcttattttatgataannnnnnnnaagaaagatgtcaaatccttc |
74 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34960626 |
attataaccggaccatttcagcctcttattttatgataattttttttaagaaagatgtcaaatccttc |
34960559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000006
Query Start/End: Original strand, 140 - 174
Target Start/End: Complemental strand, 34960493 - 34960459
Alignment:
| Q |
140 |
ttgatattttccaaacattttctctcatgttctca |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
34960493 |
ttgatattttccaaacattttctctcatgttctca |
34960459 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University