View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1686-Insertion-7 (Length: 208)
Name: NF1686-Insertion-7
Description: NF1686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1686-Insertion-7 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 8 - 208
Target Start/End: Original strand, 44729524 - 44729727
Alignment:
| Q |
8 |
aaaatatctgccatcaagtagccaagggttaacatttgtgtccttatttcaacccctgaattctgctcttaaatatggaccccacagcttttctccctcc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44729524 |
aaaatatctgccatcaagtagccaagggttaacatttgtgtccttatttcaacccctgaattctgctcttaaatatggaccccacagcttttctccctcc |
44729623 |
T |
 |
| Q |
108 |
acata---accttcatagcgcttctaacaatagccatcacatcagtatgccttctaatatcacaactaaacttccttcaatgacactagtattaatttgg |
204 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44729624 |
acataaccaccttcatagcgcttctaacaatagccatcacatcagtatgccttctaatatcacaactaaacttccttcaatgacactagtattaatttgg |
44729723 |
T |
 |
| Q |
205 |
atta |
208 |
Q |
| |
|
|||| |
|
|
| T |
44729724 |
atta |
44729727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University