View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16860_low_6 (Length: 229)
Name: NF16860_low_6
Description: NF16860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16860_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 2 - 212
Target Start/End: Original strand, 35928181 - 35928390
Alignment:
| Q |
2 |
atgagatggacatcatccgcaagatatgataagaggttatcctatcttgatgtcttatttaattttaatccaactcttttattctatctatctcttagaa |
101 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35928181 |
atgagatgaacatcatacgcaagatatgataagagcttatcctatcttgatgtgttatttaattttaatccaactcttttattctatctatctcttagaa |
35928280 |
T |
|
| Q |
102 |
tcatgaagtgagtaaagaaaacttgtccaactttattacgaaaaagtagagcactatatcatgcatgctatatagccacatgatcacattatgtgaagag |
201 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35928281 |
tcatgaagtgagtaaag-aaacttgtccaactttattacgaaaaagtagagcactatatcatgcatgctatatagccacatgatcacattatgtgaagag |
35928379 |
T |
|
| Q |
202 |
ggcagttacaa |
212 |
Q |
| |
|
||||||||||| |
|
|
| T |
35928380 |
ggcagttacaa |
35928390 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University