View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16862_low_2 (Length: 310)
Name: NF16862_low_2
Description: NF16862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16862_low_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 5 - 299
Target Start/End: Original strand, 22061533 - 22061831
Alignment:
| Q |
5 |
ggacatcatcatcatccccagaaatacaatcttcaccagcgatctccatctctgatcagtttatcagcaaaacctccaattcatgctcctgttactcctc |
104 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22061533 |
ggacatcatcatcatccccggaaatacaatcttcaccagcgatctccatctctgatcagtttatcagcaaaacctccaattcatgctcctgttactcctc |
22061632 |
T |
|
| Q |
105 |
cactccgataatccttccttcttcgcttcaacacctaaatccggccaattgtttctgacgataataccaaaggttcactcgccggcgatggatttcggtg |
204 |
Q |
| |
|
|||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22061633 |
cactccgatattccttccttcttcgctccaacacctaaatccggccaattgtttctgacgataataccaaaggttcactcgccggcgatggatttcggtg |
22061732 |
T |
|
| Q |
205 |
ttggattgtcggcgaacccta----ttaattatatccaaaatggtgctaacatctttgacaaaatcatcatcccttagatgtaactgattactattctt |
299 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
22061733 |
ttggattgtcggcgaaccctattcgttaattatatccaaaatggtgttaacatctttgacaaaatgatcatcccttagatgtaactgattactattctt |
22061831 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 52; Significance: 8e-21; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 228 - 299
Target Start/End: Complemental strand, 32904337 - 32904266
Alignment:
| Q |
228 |
aattatatccaaaatggtgctaacatctttgacaaaatcatcatcccttagatgtaactgattactattctt |
299 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |||||||||||| |||||||||| |||||||||| |
|
|
| T |
32904337 |
aattatatccaaaatggtcttaacatctttgacaaaaccatcatcccttaaatgtaactgactactattctt |
32904266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University