View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16864_low_5 (Length: 218)
Name: NF16864_low_5
Description: NF16864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16864_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 12 - 203
Target Start/End: Complemental strand, 8903163 - 8902972
Alignment:
| Q |
12 |
tcatcagatgaaggatcaattttaatcggagacattgcagtttctctcaggtaaattcactttcttctctcttctttattagggttttgaaaaaacagtc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8903163 |
tcatcagatgaaggatcaattttaatcggagacattgcagtttctctcaggtaaattcactttcttctctcttctttattagggttttgaaaaaacagtc |
8903064 |
T |
 |
| Q |
112 |
nnnnnnncatgtaataaatatcgtcattccaccaacgtagaatgcttaaattgacatgcatttcattcccatgattctcaatcgtataaagt |
203 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
8903063 |
aaaaaagcatgtaataaatatcatcattccaccaacgtagaatgcttaaattgacatgcatttgattcccatgattctcaatcgtataaagt |
8902972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University