View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16865_low_4 (Length: 398)
Name: NF16865_low_4
Description: NF16865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16865_low_4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 78 - 382
Target Start/End: Original strand, 40625730 - 40626032
Alignment:
| Q |
78 |
catcaactcatttgaatgttctttatcagtgtattaatgatttggtgttttgtttttgttatgaaaaggaccctcatgtagggatacagtagaaagtaga |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40625730 |
catcaactcatttgaatgttctttatcagtgtattaatgatttggtgttttgtttttgttatgaaaaggaccctcatgtagggatacagtagaaagtaga |
40625829 |
T |
|
| Q |
178 |
tacataaatttactacaatatatatannnnnnnatcaggaacccaattgctgcctttctcaagttcacatgtatacccttctactgctatgatgaatcct |
277 |
Q |
| |
|
||||||||||||||||||||||| | |||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40625830 |
tacataaatttactacaatatattt--ttttttatcaggcacccaattgctgccattctcaagttcacatgtatacccttctactgctatgatgaatcct |
40625927 |
T |
|
| Q |
278 |
acttgggttggaggagatgttaggctccatagccacaatcaacaccaacaattgcaccatctggtcgataaacaagacctttttcttggaacaacatctt |
377 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40625928 |
acttgggttggaggagatgttaggctccatagccacaatcaacaccaacaaatgcaccatctggtcgataaacaagacctttttcttggaacaacatctt |
40626027 |
T |
|
| Q |
378 |
caacc |
382 |
Q |
| |
|
||||| |
|
|
| T |
40626028 |
caacc |
40626032 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University