View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16866_low_4 (Length: 279)
Name: NF16866_low_4
Description: NF16866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16866_low_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 254
Target Start/End: Original strand, 38829632 - 38829885
Alignment:
| Q |
1 |
gatttgaaggctaagaattacttgtttcagtcaattgacaagtcaattctgaagaccatcacgcagaaggagacatctaaatagctatgggattccatga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||| | |||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
38829632 |
gatttgaaggctaagaattacttgtttcagttaattgacaagtcaattctgaagacgaacacgcagaaggagacatctaaacggctatgggattccatga |
38829731 |
T |
 |
| Q |
101 |
agttgaagtgtcgcggcaatgctcgagtgaagagagcacagcttaatcgtctacgccgagactttgaggtcttagcaatgaagcagggtgaatcgatcac |
200 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| || |||| ||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
38829732 |
agttgaagtgtcgcgacaatgctcgagtgaagagagcacaactcaatcatctacgccgagactttgaggtcttagcaatgaagcagggtgaatcaatcac |
38829831 |
T |
 |
| Q |
201 |
tgattattttagtcgagtaatgacagttgcaaacgacatgaggaattatgggga |
254 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
38829832 |
tgattattttggtcgagtaatgacggttgcaaacgacatgaggaattatgggga |
38829885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University