View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16866_low_6 (Length: 224)
Name: NF16866_low_6
Description: NF16866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16866_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 182; Significance: 1e-98; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 26 - 219
Target Start/End: Original strand, 42824938 - 42825131
Alignment:
| Q |
26 |
acatggtgctaaagttatcattgcagatattcaagatgaagtaggtcaatccctttgcaatgaacttggcacaaagaacattctctatgttcactgcaat |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
42824938 |
acatggtgctaaagttatcattgcagatattcaagatgaagtaggtcaatccctttgcaatgaacttggcccaaagaacattctctatgttcactgcaat |
42825037 |
T |
|
| Q |
126 |
gtaaccactgaatcagacataaaaaacgtggttgataccgcagttttgaattatggtaagcttgacatcatgtttaacaatgctggtatctctg |
219 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42825038 |
gtaaccactgaatcagacataaaaaatgtggttgataccgcagtttcgaattatggtaagcttgacatcatgtttaacaatgctggtatctctg |
42825131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 28 - 216
Target Start/End: Original strand, 42821302 - 42821490
Alignment:
| Q |
28 |
atggtgctaaagttatcattgcagatattcaagatgaagtaggtcaatccctttgcaatgaacttggcacaaagaacattctctatgttcactgcaatgt |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| |||| ||||| |||||||| | |||||||||||||||||||| | |||||||||| |||| |
|
|
| T |
42821302 |
atggtgctaaagttatcattgcagatattcaagacgaattaggccaatctctttgcaaaaatcttggcacaaagaacattctttgtgttcactgcgatgt |
42821401 |
T |
|
| Q |
128 |
aaccactgaatcagacataaaaaacgtggttgataccgcagttttgaattatggtaagcttgacatcatgtttaacaatgctggtatct |
216 |
Q |
| |
|
||| | |||||||||||| |||| ||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42821402 |
aactattgaatcagacatcaaaaccgtggttgatatcgcagtttcaaattatggtaagcttgacatcatgtttaacaatgctggtatct |
42821490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University