View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16867_high_2 (Length: 241)
Name: NF16867_high_2
Description: NF16867
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16867_high_2 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 11 - 241
Target Start/End: Original strand, 35357640 - 35357871
Alignment:
| Q |
11 |
tatgaatcatcatgtattgtttttaaagaagaaagaactcatatatttggctctacaactaaattaatgtttcattgaaatatccttttgattgaacttc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35357640 |
tatgaatcatcatgtattgtttttaaagaagaaagaactcatatatttggctatacaactcaattaatgtttcattgaaatatccttttgattgaacttc |
35357739 |
T |
 |
| Q |
111 |
ttgtgggattccctctannnnnnnnnnnnnccgtttatattacatttctaacgatgttttttggtatcagctttgaggtattagtggctgatcttgagga |
210 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35357740 |
ttgtgggattccctctatttttttatttttccgtttatattacatttctaacgatgttttttggtatcagctttggggtattagtggctgatcttgagga |
35357839 |
T |
 |
| Q |
211 |
gtagctcta-gggcacaacagttttggttcgt |
241 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |
|
|
| T |
35357840 |
gtagctctaggggcacaacagttttggttcgt |
35357871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University