View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16868_high_7 (Length: 248)
Name: NF16868_high_7
Description: NF16868
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16868_high_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 11998086 - 11997867
Alignment:
| Q |
1 |
gtctgccttagtaagacaagaagaagttatggcactgtctttggtaagatcatgagatgattcttgtaagtatatgttggaacctacttggctgcttact |
100 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11998086 |
gtctggcttagtaagacaagaagaagttgtggcactgtctttggtaagatcatgagatgattcttgtaagtatatgttggaacctacttggctgcttact |
11997987 |
T |
|
| Q |
101 |
tctaagctattttcagcttccaagttcaaatttggagtcttcattatgttgatatggaacaagtctttacctacattaatgattaaatgcattatttttc |
200 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
11997986 |
tctaaactattttcagcttccaagttcaaatttggagtcttcatcatgttgatatggaacaaatctttacctacattattgattaaatgcatta-ttttc |
11997888 |
T |
|
| Q |
201 |
tatgttaatcacaaaaatttg |
221 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
11997887 |
tatgttaatcacaaaagtttg |
11997867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University