View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16868_high_8 (Length: 242)
Name: NF16868_high_8
Description: NF16868
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16868_high_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 237; Significance: 1e-131; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 11998164 - 11998400
Alignment:
| Q |
1 |
cactaacagtgaagtactaggagctgatcaagctcataatactgtttccgcaccaacgattcatagagttttctcttgtaattattgtaggaggaaattc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11998164 |
cactaacagtgaagtactaggagctgatcaagctcataatactgtttccgcaccaacgattcatagagttttctcttgtaattattgtaggaggaaattc |
11998263 |
T |
 |
| Q |
101 |
tttagctcgcaagcattaggtggacatcagaatgctcataaaagggagagaacattggcgaagcgcgctatgcgagtagggatgtttaccgaaaggtata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11998264 |
tttagctcgcaagcattaggtggacatcagaatgctcataaaagggagagaacattggcgaagcgcgctatgcgagtagggatgtttaccgaaaggtata |
11998363 |
T |
 |
| Q |
201 |
caagcttagcttctttacctcttcatggttcttcttc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11998364 |
caagcttagcttctttacctcttcatggttcttcttc |
11998400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 65 - 151
Target Start/End: Complemental strand, 2867221 - 2867135
Alignment:
| Q |
65 |
agagttttctcttgtaattattgtaggaggaaattctttagctcgcaagcattaggtggacatcagaatgctcataaaagggagaga |
151 |
Q |
| |
|
|||||||| |||||||| |||||| || ||||||| |||||| ||||||||||||||||| || |||||||| ||||| |||||| |
|
|
| T |
2867221 |
agagttttttcttgtaactattgtcatagaaaattctatagctcacaagcattaggtggacaccaaaatgctcacaaaagagagaga |
2867135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University