View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1686_high_12 (Length: 227)
Name: NF1686_high_12
Description: NF1686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1686_high_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 7 - 94
Target Start/End: Complemental strand, 9394728 - 9394641
Alignment:
| Q |
7 |
agtctctctttaaaacatagatagagagatatttgaagcaatgatagtccccaatttgagtactctgtgtacttctatcatgtgacct |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
9394728 |
agtctctctttaaaacatagatagagagatatttgaagcaatgatagtcccgaatctgagtactctttgtacttctatcatgtgacct |
9394641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 149 - 227
Target Start/End: Complemental strand, 9394586 - 9394506
Alignment:
| Q |
149 |
acacacgcacatgcacgcacgcgcatactatccgccattaa--aaaacactctgagatggataggagtgcctttatttgta |
227 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||||||| |||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
9394586 |
acacacgcacatgcacgcacacgcatactatctgccattaaaaaaaacactttgagatgaataggagtgcctttatttgta |
9394506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University