View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1686_low_14 (Length: 205)

Name: NF1686_low_14
Description: NF1686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1686_low_14
NF1686_low_14
[»] chr5 (1 HSPs)
chr5 (26-188)||(37833237-37833399)


Alignment Details
Target: chr5 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 26 - 188
Target Start/End: Complemental strand, 37833399 - 37833237
Alignment:
26 aaacaaatttgttgaatccaaaactgacatatcagcactaaatattagaatagttagcaaaatttgatattgaataatggttaactatggatattgacat 125  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37833399 aaacaaatttgttgaatccaaaactgacatatcagcactaaatattagaatagttagcaaaatttgatattgaataatggttaactatggatattgacat 37833300  T
126 ggcactctaataggctgccccttagagattatagattacaaatagatagattaagttcctatg 188  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37833299 ggcactctaataggctgccccttagagattatagattacaaatagatagattaagttcctatg 37833237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University