View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1686_low_7 (Length: 321)
Name: NF1686_low_7
Description: NF1686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1686_low_7 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 188 - 321
Target Start/End: Complemental strand, 2590205 - 2590072
Alignment:
| Q |
188 |
aatattcttcataaaccttagacgacagacatatcagattcactcttcacatatatgcttaacactactatgtaggcatcccaaagaataccttatgtag |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
2590205 |
aatattcttcataaaccttagacgacagacatatcagattcactcttcacatatatgcttaatactactatgtaggcatcccaaagaacaccttatgtag |
2590106 |
T |
 |
| Q |
288 |
actattaaaaacaagacaaacttaactaaagaac |
321 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||| |
|
|
| T |
2590105 |
actattgaaaacaacacaaacttaactaaagaac |
2590072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 18 - 98
Target Start/End: Complemental strand, 2590413 - 2590333
Alignment:
| Q |
18 |
taaagtacattaagtttgcttcaattttcttttatattaattaaagcatagtaattagtaggaaaagtaagttactatgac |
98 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
2590413 |
taaagtatattaagtttgcttcaattttcttttatattaattaaagcatagtaaatagtaggaaaagtaagttactatgac |
2590333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University