View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1687-Insertion-13 (Length: 81)

Name: NF1687-Insertion-13
Description: NF1687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1687-Insertion-13
NF1687-Insertion-13
[»] chr4 (2 HSPs)
chr4 (36-78)||(26382568-26382610)
chr4 (8-51)||(26382526-26382569)
[»] chr5 (2 HSPs)
chr5 (8-51)||(11386957-11387000)
chr5 (36-78)||(11386999-11387041)


Alignment Details
Target: chr4 (Bit Score: 43; Significance: 4e-16; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 43; E-Value: 4e-16
Query Start/End: Original strand, 36 - 78
Target Start/End: Original strand, 26382568 - 26382610
Alignment:
36 cttctattatgtaactgtcaattgttccaccgtccatcttctt 78  Q
    |||||||||||||||||||||||||||||||||||||||||||    
26382568 cttctattatgtaactgtcaattgttccaccgtccatcttctt 26382610  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.00000000000002
Query Start/End: Original strand, 8 - 51
Target Start/End: Original strand, 26382526 - 26382569
Alignment:
8 attgatattgatacatattcagatagttcttctattatgtaact 51  Q
    |||||| |||||||||||||||||||||||||||||||||||||    
26382526 attgatgttgatacatattcagatagttcttctattatgtaact 26382569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 40; Significance: 0.00000000000002; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.00000000000002
Query Start/End: Original strand, 8 - 51
Target Start/End: Original strand, 11386957 - 11387000
Alignment:
8 attgatattgatacatattcagatagttcttctattatgtaact 51  Q
    |||||| |||||||||||||||||||||||||||||||||||||    
11386957 attgatgttgatacatattcagatagttcttctattatgtaact 11387000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000001
Query Start/End: Original strand, 36 - 78
Target Start/End: Original strand, 11386999 - 11387041
Alignment:
36 cttctattatgtaactgtcaattgttccaccgtccatcttctt 78  Q
    |||||||||||||||||||||||||||||| ||||||||||||    
11386999 cttctattatgtaactgtcaattgttccactgtccatcttctt 11387041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University