View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1687-Insertion-13 (Length: 81)
Name: NF1687-Insertion-13
Description: NF1687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1687-Insertion-13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 43; Significance: 4e-16; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 43; E-Value: 4e-16
Query Start/End: Original strand, 36 - 78
Target Start/End: Original strand, 26382568 - 26382610
Alignment:
| Q |
36 |
cttctattatgtaactgtcaattgttccaccgtccatcttctt |
78 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26382568 |
cttctattatgtaactgtcaattgttccaccgtccatcttctt |
26382610 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.00000000000002
Query Start/End: Original strand, 8 - 51
Target Start/End: Original strand, 26382526 - 26382569
Alignment:
| Q |
8 |
attgatattgatacatattcagatagttcttctattatgtaact |
51 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26382526 |
attgatgttgatacatattcagatagttcttctattatgtaact |
26382569 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 40; Significance: 0.00000000000002; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.00000000000002
Query Start/End: Original strand, 8 - 51
Target Start/End: Original strand, 11386957 - 11387000
Alignment:
| Q |
8 |
attgatattgatacatattcagatagttcttctattatgtaact |
51 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11386957 |
attgatgttgatacatattcagatagttcttctattatgtaact |
11387000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000001
Query Start/End: Original strand, 36 - 78
Target Start/End: Original strand, 11386999 - 11387041
Alignment:
| Q |
36 |
cttctattatgtaactgtcaattgttccaccgtccatcttctt |
78 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
11386999 |
cttctattatgtaactgtcaattgttccactgtccatcttctt |
11387041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University