View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1687-Insertion-4 (Length: 403)
Name: NF1687-Insertion-4
Description: NF1687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1687-Insertion-4 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 364; Significance: 0; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 364; E-Value: 0
Query Start/End: Original strand, 8 - 403
Target Start/End: Complemental strand, 16685065 - 16684670
Alignment:
| Q |
8 |
tacataacatgttaaaagaagcagcttgcattgccaagtctatggctttatgtaagggttttggatttaaggttgaggtcgataggtctttgcctaacta |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
16685065 |
tacataacatgttaaaagaagcagcttgcattgccaagtctatggctttatgtaagggttttggatttaaggttgaggttgataggtctttgcctaacta |
16684966 |
T |
|
| Q |
108 |
tgttatcggtgacgagaagagggtttttcaggtgattttgcacatggttaggaatttgatagacggtaacaatgggggagggattcttgtgtttcaagtt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
16684965 |
tgttatcggtgacgagaagagggtttttcaggtgattttgcacatggttaggaacttgattgatggtaacaatgggggagggattcttgtgtttcaagtt |
16684866 |
T |
|
| Q |
208 |
ttcgcagaatctggaagtcgaggaaggagtgaacatggatatgcaacttggagaccaagctcgtctagcggtgatgtgcatgttagatttgacataggga |
307 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
16684865 |
ttggcagaatctggaagtcgaggaaggagtgaacctggatatgcaacttggagaccaagctcgtctaacggtgatgtgcatgttagatttgacataggga |
16684766 |
T |
|
| Q |
308 |
tcaatagcagtaattctgaatcagagacctcagttacttcagggaggcttgcaggaaggatgcgtacgagtgatcgggcactccaggaaagtttga |
403 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
16684765 |
tcaatagcagtaattctgaatcagagacctcagttacttcagggaggcttgcaggaaggatgcgtacgagtgatcgggcactcgaggaaagtttga |
16684670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 15 - 311
Target Start/End: Original strand, 32790027 - 32790326
Alignment:
| Q |
15 |
catgttaaaagaagcagcttgcattgccaagtctatggctttatgtaagggttttggatttaaggttgaggtcgataggtctttgcctaactatgttatc |
114 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||| | ||| | | | |||||| || || |||| ||||||||| |||| |||||| || ||| ||||||| |
|
|
| T |
32790027 |
catgataaaagaagcagcgtgccttgccaaatgcatgtgtgtttataagggcttgggttttatggttgaggttgataagtctttaccaaaccatgttatg |
32790126 |
T |
|
| Q |
115 |
ggtgacgagaagagggtttttcaggtgattttgcacatggttaggaatttgatagacggtaacaatggg---ggagggattcttgtgtttcaagttttcg |
211 |
Q |
| |
|
||||| |||| |||||||||||||||||||||||| |||||| ||||| | | || ||||| ||||| || ||||| || || |||| |||| | |
|
|
| T |
32790127 |
ggtgatgagaggagggtttttcaggtgattttgcatatggttgggaatctactggattgtaaccatggggaaggggggatcctagtatttcgggtttcgg |
32790226 |
T |
|
| Q |
212 |
cagaatctggaagtcgaggaaggagtgaacatggatatgcaacttggagaccaagctcgtctagcggtgatgtgcatgttagatttgacatagggatcaa |
311 |
Q |
| |
|
|||| ||||||||| ||| |||| |||| | |||| ||||| |||||||||||||| |||||||||||||| || |||||||||| ||||||||||| |
|
|
| T |
32790227 |
cagatgctggaagtcaagggaggaatgaaaaaggatgggcaacctggagaccaagctcatctagcggtgatgtaaatattagatttgagatagggatcaa |
32790326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University