View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1687-Insertion-7 (Length: 305)
Name: NF1687-Insertion-7
Description: NF1687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1687-Insertion-7 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 8 - 305
Target Start/End: Original strand, 38683898 - 38684195
Alignment:
| Q |
8 |
ttcagcaccccaggtttcggtaccccttcttcaactcctgcttttggtgcttcttctacacccgctttcggtggtggttcttccctcttctcaacacctt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
38683898 |
ttcagcaccccaggtttcggtaccccttcttcaactcctgcttttggtgcttcttctacacccgctttcggtggtggttcttccctcttctcaacaccgt |
38683997 |
T |
|
| Q |
108 |
tctctgctcaactacaatcccaacaacagcggcagcaacagcagaattcactctttcaactatcaccttctactggttttgggtttcagaattctacgcc |
207 |
Q |
| |
|
|||||||||||| |||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38683998 |
tctctgctcaacaacaaccccaacaacagcagcagcaacagcagaattcactctttcaactatcaccttctactggttttgggtttcagaattctacgcc |
38684097 |
T |
|
| Q |
208 |
agcgccgcaaccttcgccgtttccaaattctcaattgactactcaaatggctaatgttgctccagttccattctcactggcggatcgtgatattcaag |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38684098 |
agcgccgcaaccttcgccgtttccaaattctcaattgactactcaaatggctaatgttgctccagttccattctcactggcggatcgtgatattcaag |
38684195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 251 - 305
Target Start/End: Complemental strand, 4160599 - 4160545
Alignment:
| Q |
251 |
caaatggctaatgttgctccagttccattctcactggcggatcgtgatattcaag |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
4160599 |
caaatggctaatgttgctccagttccattctcaccgaaggatcgtgatattcaag |
4160545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 81 - 138
Target Start/End: Complemental strand, 7895175 - 7895118
Alignment:
| Q |
81 |
gtggttcttccctcttctcaacacctttctctgctcaactacaatcccaacaacagcg |
138 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||||| |||| | ||||||||||| |
|
|
| T |
7895175 |
gtggttcttccctcttctcagcaccgttctctgctcaacaacaaccgcaacaacagcg |
7895118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University