View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16870_high_6 (Length: 321)
Name: NF16870_high_6
Description: NF16870
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16870_high_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 16 - 292
Target Start/End: Original strand, 34899698 - 34899975
Alignment:
| Q |
16 |
atgcaaatgttataataag-taggcaatgagatgg-acatcatcatattgtcagtgatatcatctgcacaaattcacataaaattttgtagttggaagat |
113 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||| | || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899698 |
atgcaaatgttataataagataggcaa-gagataccaaattatcatattgtcagtgatatcatctgcacaaattcacataaaattttgtagttggaagat |
34899796 |
T |
|
| Q |
114 |
acatacctttcatgttcggtgagaatggaaggaaaattttgagactataaggttgcatacacgcaggggaagacacaatttagcttttgttgacatcaaa |
213 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899797 |
acatacctttcatgtttggtgagaatggaaggaaaattttgagactataaggttgcatacacgcaggggaagacacaatttagcttttgttgacatcaaa |
34899896 |
T |
|
| Q |
214 |
tagcgagagaagaactaaagagagatgtgtttatatgcatataggtaaagtttggtagtttcaactttcaagttgagat |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899897 |
tagcgagagaagaactaaagagagatgtgtttatatgcatataggtaaagtttggtagtttcaactttcaagttgagat |
34899975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University