View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16871_low_6 (Length: 255)

Name: NF16871_low_6
Description: NF16871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16871_low_6
NF16871_low_6
[»] chr4 (2 HSPs)
chr4 (11-114)||(46185227-46185330)
chr4 (136-239)||(46185079-46185190)


Alignment Details
Target: chr4 (Bit Score: 96; Significance: 4e-47; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 11 - 114
Target Start/End: Complemental strand, 46185330 - 46185227
Alignment:
11 cacagaccaaaaaagtaacaaaagaatataaagatgacataacttaattccactaacaattatgattacgtacacacaccttaacttaattttgaaccat 110  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
46185330 cacacaccaaaaaagtaacaaaagaatataaagatgacataacttaattccactaacaattatgattacgtacacacaccttaacttaatattgaaccat 46185231  T
111 acat 114  Q
    ||||    
46185230 acat 46185227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 136 - 239
Target Start/End: Complemental strand, 46185190 - 46185079
Alignment:
136 cccggttgaatataaatatatgatagtataagctagtgaaccaacc--------gaaccggtttggttcaatcaagcaccaggagctgcatccttaacct 227  Q
    ||||||||||||||||||||||||||||||||||||||||||||||        ||||||||||||||||||||||||||||||||||||||||||||||    
46185190 cccggttgaatataaatatatgatagtataagctagtgaaccaaccaaccaaccgaaccggtttggttcaatcaagcaccaggagctgcatccttaacct 46185091  T
228 tactctgcaaat 239  Q
    ||||||||||||    
46185090 tactctgcaaat 46185079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University