View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16871_low_6 (Length: 255)
Name: NF16871_low_6
Description: NF16871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16871_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 96; Significance: 4e-47; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 11 - 114
Target Start/End: Complemental strand, 46185330 - 46185227
Alignment:
| Q |
11 |
cacagaccaaaaaagtaacaaaagaatataaagatgacataacttaattccactaacaattatgattacgtacacacaccttaacttaattttgaaccat |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
46185330 |
cacacaccaaaaaagtaacaaaagaatataaagatgacataacttaattccactaacaattatgattacgtacacacaccttaacttaatattgaaccat |
46185231 |
T |
|
| Q |
111 |
acat |
114 |
Q |
| |
|
|||| |
|
|
| T |
46185230 |
acat |
46185227 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 136 - 239
Target Start/End: Complemental strand, 46185190 - 46185079
Alignment:
| Q |
136 |
cccggttgaatataaatatatgatagtataagctagtgaaccaacc--------gaaccggtttggttcaatcaagcaccaggagctgcatccttaacct |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46185190 |
cccggttgaatataaatatatgatagtataagctagtgaaccaaccaaccaaccgaaccggtttggttcaatcaagcaccaggagctgcatccttaacct |
46185091 |
T |
|
| Q |
228 |
tactctgcaaat |
239 |
Q |
| |
|
|||||||||||| |
|
|
| T |
46185090 |
tactctgcaaat |
46185079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University