View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16873_low_2 (Length: 377)
Name: NF16873_low_2
Description: NF16873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16873_low_2 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 69; Significance: 7e-31; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 30 - 129
Target Start/End: Complemental strand, 35035691 - 35035591
Alignment:
| Q |
30 |
ttttattaatggctacttgtctctt-ttttgttgttgttgaagaagtcaaattagtctatcaaaattgacatcttaacatgaatacatttcaaggtccaa |
128 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| | || |||| |||||||||||||| |
|
|
| T |
35035691 |
ttttatcaatggctacttgtctctccttttgttgttgttgaagaagtcaaattagtctatcaaaattgacatcttgaaataaatatatttcaaggtccaa |
35035592 |
T |
|
| Q |
129 |
a |
129 |
Q |
| |
|
| |
|
|
| T |
35035591 |
a |
35035591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 30 - 129
Target Start/End: Complemental strand, 35025600 - 35025503
Alignment:
| Q |
30 |
ttttattaatggctacttgtctcttttttgttgttgttgaagaagtcaaattagtctatcaaaattgacatcttaacatgaatacatttcaaggtccaaa |
129 |
Q |
| |
|
|||||| |||||||||||||| ||||||| || || ||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
35025600 |
ttttatcaatggctacttgtccctttttttttttt--tgaagaagtcaaattagtctatcaaaattgacatcttgaaatgaatacatttcaaggtccaaa |
35025503 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 180 - 237
Target Start/End: Complemental strand, 35043206 - 35043149
Alignment:
| Q |
180 |
attccagtaagtattggctcttattctattggaagatatcattcatttttataatttt |
237 |
Q |
| |
|
||||| ||||||||||| | | ||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
35043206 |
attcccgtaagtattggttttcattctattggaagatatcagtcaattttataatttt |
35043149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 55 - 99
Target Start/End: Complemental strand, 20094241 - 20094197
Alignment:
| Q |
55 |
ttttgttgttgttgaagaagtcaaattagtctatcaaaattgaca |
99 |
Q |
| |
|
|||| |||||||||||||||| ||||||||| ||| ||||||||| |
|
|
| T |
20094241 |
tttttttgttgttgaagaagttaaattagtccatctaaattgaca |
20094197 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University