View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16874_low_8 (Length: 207)
Name: NF16874_low_8
Description: NF16874
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16874_low_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 58 - 192
Target Start/End: Original strand, 51629762 - 51629896
Alignment:
| Q |
58 |
ttgatgaagttactgattttggacagctattatacatctagagcggctaaattttttagcctaagtttgcatgcatggattgatattcctttattaaaca |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51629762 |
ttgatgaagttactgattttggacagctattatacatctagagcggctaaattttttagcctaagtttgcatgcatggattgatattcctttattaaaca |
51629861 |
T |
|
| Q |
158 |
ttcttttatagaatgattgtaatgaactttcttct |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
51629862 |
ttcttttatagaatgattgtaatgaactttcttct |
51629896 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 20 - 61
Target Start/End: Original strand, 51629559 - 51629600
Alignment:
| Q |
20 |
gatatggaaagagaatatactcatagttttcacatggcttga |
61 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51629559 |
gatatggaaagagaatatactcatagttttcacatggcttga |
51629600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University