View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16874_low_8 (Length: 207)

Name: NF16874_low_8
Description: NF16874
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16874_low_8
NF16874_low_8
[»] chr3 (2 HSPs)
chr3 (58-192)||(51629762-51629896)
chr3 (20-61)||(51629559-51629600)


Alignment Details
Target: chr3 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 58 - 192
Target Start/End: Original strand, 51629762 - 51629896
Alignment:
58 ttgatgaagttactgattttggacagctattatacatctagagcggctaaattttttagcctaagtttgcatgcatggattgatattcctttattaaaca 157  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51629762 ttgatgaagttactgattttggacagctattatacatctagagcggctaaattttttagcctaagtttgcatgcatggattgatattcctttattaaaca 51629861  T
158 ttcttttatagaatgattgtaatgaactttcttct 192  Q
    |||||||||||||||||||||||||||||||||||    
51629862 ttcttttatagaatgattgtaatgaactttcttct 51629896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 20 - 61
Target Start/End: Original strand, 51629559 - 51629600
Alignment:
20 gatatggaaagagaatatactcatagttttcacatggcttga 61  Q
    ||||||||||||||||||||||||||||||||||||||||||    
51629559 gatatggaaagagaatatactcatagttttcacatggcttga 51629600  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University