View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16875_high_3 (Length: 288)
Name: NF16875_high_3
Description: NF16875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16875_high_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 18 - 283
Target Start/End: Complemental strand, 41640554 - 41640289
Alignment:
| Q |
18 |
ttgggaaggttatagttgcgtgttatgtccctattgggagtcttggagtcctttgattatgtggtgctgttttatcgtggaaacaattccttattttggg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
41640554 |
ttgggaaggttatagttgcgtgttatgtccctattgggagtcttggagtcctttgattatgtggtgctgttttatcgtggaaacaattccttattttgag |
41640455 |
T |
 |
| Q |
118 |
tacaagctagataatgcattttttggattggattcgtccctccaactgaaatgtggttcccttactttttagttttgagttatatatggaccaatggaaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41640454 |
tacaagctagataatgcattttttggattggattcgtccctcaaactgaaatgtggttcccttactttttagttttgagttatatatggaccaatggaaa |
41640355 |
T |
 |
| Q |
218 |
ttctttagtgtgttgtaaaattgtgggtcatatttttgtttccacacttcatatccctatgctact |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
41640354 |
ttctttagtgtgttgtaaaattgtgggtcatatttttgttaccacacttcatatccctatgatact |
41640289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University