View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16876_low_10 (Length: 217)
Name: NF16876_low_10
Description: NF16876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16876_low_10 |
 |  |
|
| [»] scaffold0062 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0062 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: scaffold0062
Description:
Target: scaffold0062; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 19 - 210
Target Start/End: Complemental strand, 6332 - 6125
Alignment:
| Q |
19 |
gataaagatgaaagattgcataataaatttcttatttgattacaacttcaatttcaatttgaaaagtnnnnnnnttgttgtttttcaatgaaaatattat |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
6332 |
gataaagatgaaagattgcataataaatttcttatttgattacaacttcaatttcaatttgaaaagtaaaaaaattgttgtttttcaatgaaaatattat |
6233 |
T |
 |
| Q |
119 |
gcattttattattaactattattacaagcacatgatatattgataaaagagaag----------------caatataatacaaaagcacacacaaaatta |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
6232 |
gcattttattattaactattattacaagcacatgatatattgataaaagagaagtaattctccacactcacaatataatacaaaagcacacacaaaatta |
6133 |
T |
 |
| Q |
203 |
caagtaca |
210 |
Q |
| |
|
|||||||| |
|
|
| T |
6132 |
caagtaca |
6125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University