View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16876_low_4 (Length: 386)
Name: NF16876_low_4
Description: NF16876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16876_low_4 |
 | |
|
| [»] scaffold0649 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0649 (Bit Score: 321; Significance: 0; HSPs: 1)
Name: scaffold0649
Description:
Target: scaffold0649; HSP #1
Raw Score: 321; E-Value: 0
Query Start/End: Original strand, 11 - 371
Target Start/End: Complemental strand, 5411 - 5051
Alignment:
| Q |
11 |
caaaggcaatctgccaatacgcaaacaattggcataatcggtggtatttcagcaaaatctagaggtacgagcaactgtgtgcattcgtccgtccccaaat |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
5411 |
caaaggcaatctgccaatacgcaaacaattggcataataggtggtatttcatcaaaatctagaggtacgagcaactgtgtgcattcctccgtccccaaat |
5312 |
T |
|
| Q |
111 |
caagcgagataatgccaaattgttcaatcgtatcgttaagatctttccaatccgagtaaagataaacaatgttattgcaaagggtaaaccaattaagact |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5311 |
caagcgagataatgccaaattgttcaatcgtatcgttaagatctttccaatccgagtaaagataaacaatgttattgcaaagggtaaaccaattaagact |
5212 |
T |
|
| Q |
211 |
gttgctaaaatagacaccaccattctgatccaaaccagtctgagcggaacgagtgcaacgaaaaggagtcgatgggaaactttcaatactcttccaaaca |
310 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
5211 |
gttactaaaatagacaccaccattctgatccaaaccagtccgagcagaacgagtgcaacgaaaaggagtcgaagggaaactttcaatactcttccaaaca |
5112 |
T |
|
| Q |
311 |
tgatcacctaaactaaacacttttgcaataccgggactataagccaccaccttatattttc |
371 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
5111 |
tgatcacctaaactaaacactttcgcaataccgggactataggccacaaccttatattttc |
5051 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 101 - 142
Target Start/End: Original strand, 15572097 - 15572138
Alignment:
| Q |
101 |
gtccccaaatcaagcgagataatgccaaattgttcaatcgta |
142 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
15572097 |
gtccccaaatcaagcgagattatcacaaattgttcaatcgta |
15572138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University