View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16878_low_10 (Length: 202)
Name: NF16878_low_10
Description: NF16878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16878_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 8e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 8e-97
Query Start/End: Original strand, 1 - 191
Target Start/End: Original strand, 7723417 - 7723607
Alignment:
| Q |
1 |
taaactgattacaacaaccctttgaaatttcttctttgctacactatcctttaagattatgtaactcaatcagatctatgtctttgagtgattcaaaaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
7723417 |
taaactgattacaacaaccctttgaaatttcttctttgctacactatcctttaagattatgtaactcaatcagatctatgtctttgagtgattcagaaaa |
7723516 |
T |
 |
| Q |
101 |
ggttgatgctatccactctaggaaaggtaaatatccataattttaatttcgttccaattcaatgtcaagcaaccaatcattccaaacctct |
191 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
7723517 |
ggttgatgctatccactctaggcaaggtaaatatccataattttaatttcgttccaattcaatgtcaagcaaccaagcattccaaacctct |
7723607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University