View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16878_low_2 (Length: 440)
Name: NF16878_low_2
Description: NF16878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16878_low_2 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 397; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 397; E-Value: 0
Query Start/End: Original strand, 36 - 440
Target Start/End: Original strand, 42960330 - 42960734
Alignment:
| Q |
36 |
ttctctttcatgtgaacaaggtttatctggaattgggtcattaagcacttcttgtgatctcaattctagtataatcttcgatggtgatgtttatattgaa |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42960330 |
ttctctttcatgtgaacaaggtttatctggaattgggtcattaagcacttcttgtgatctcaattctagtataatcttcgatggtgatgtttatattgaa |
42960429 |
T |
 |
| Q |
136 |
ggaaatggaagtttaaatattcttcctggtgttaatttgacttgcccaatttcgggctgtgtgatcaaaatcaacatgagtgaagattttactttgcaaa |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42960430 |
ggaaatggaagtttaaatattcttcctggtgttaatttgacttgcccaatttcgggctgtgtgatcaaaatcaacatgagtgaagattttactttgcaaa |
42960529 |
T |
 |
| Q |
236 |
atgattctgtgattattgctggtactgtttatgttgcagcaaaaaatgcaaacttgtttgatgggtcagtggttaatgttactgggctggccggttcacc |
335 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42960530 |
atgattctgtgattattgctggtactgtttatgttgcagcaaaaaatgcaaacttgtttgatgggtcagtggttaatgttactgggctggccggttcacc |
42960629 |
T |
 |
| Q |
336 |
accggctcagaccagcggcgaaccgtccgggacacagggtgccgggggagggtatggtgggagaggtgctacgtgtgtctctgataataccaagcttcct |
435 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
42960630 |
accggctcagaccagcggcgaaccgtccgggacacagggtgccgggggagggtatggtgggagaggtgctacgtgtgtctctgataatactaagcttccc |
42960729 |
T |
 |
| Q |
436 |
gatga |
440 |
Q |
| |
|
||||| |
|
|
| T |
42960730 |
gatga |
42960734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University