View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16878_low_9 (Length: 215)
Name: NF16878_low_9
Description: NF16878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16878_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 27 - 199
Target Start/End: Original strand, 23988248 - 23988420
Alignment:
| Q |
27 |
atctatagttgaaaacaatcaaattattgagaattcgtgtttttcagaggtggaggacttctatgcaataaatacagcgttgttgcatttggctgctaaa |
126 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23988248 |
atctgtagttgaaaacaacaaaattattgagaattcgagtttttcggaggtggaggacttctatgcaataaatacagcgttgttgcatttggctgctaaa |
23988347 |
T |
|
| Q |
127 |
aaccctattaaaattggagagcttatgactggtggattaggtaccggtggaaatccacttttgggcgaacaag |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23988348 |
aaccctattaaaattggagagcttatgactggtggattaggtaccggtggaaatccacttttgggcgaacaag |
23988420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 165 - 199
Target Start/End: Complemental strand, 41108280 - 41108246
Alignment:
| Q |
165 |
aggtaccggtggaaatccacttttgggcgaacaag |
199 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |
|
|
| T |
41108280 |
aggtaccggtgggaatccacttttgggcgaacaag |
41108246 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 81
Target Start/End: Complemental strand, 13991133 - 13991095
Alignment:
| Q |
43 |
aatcaaattattgagaattcgtgtttttcagaggtggag |
81 |
Q |
| |
|
||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
13991133 |
aatcaaattattgagaattcgagtttttcaaaggtggag |
13991095 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University