View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16879_high_1 (Length: 349)
Name: NF16879_high_1
Description: NF16879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16879_high_1 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 144; Significance: 1e-75; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 181 - 328
Target Start/End: Complemental strand, 25286593 - 25286446
Alignment:
| Q |
181 |
gcacaagtttcagcagcaaggtagtttacaatcaactgaattggatccaagaattgtgcttcactatggcattccatcttcttcttcagttctcgctttt |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25286593 |
gcacaagtttcagcagcaaggtagtttacaatcaactgaattggatccaagaattgtgattcactatggcattccatcttcttcttcagttctcgctttt |
25286494 |
T |
|
| Q |
281 |
gatcccattcagcgacttttggctattgggactttgtcagtacttcat |
328 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25286493 |
gatcccattcagcgacttttggctattgggactttgtcagtacttcat |
25286446 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 29 - 103
Target Start/End: Complemental strand, 25286745 - 25286671
Alignment:
| Q |
29 |
aaccatgtttgcgaagagattgttacacaaagctgtgcaacaccattacaacgtaagaaacaaataaaaaccatg |
103 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25286745 |
aaccatgtttgctaagagattgttacacaaagctgtgcaacaccattacaacgtaagaaacaaataaaaaccatg |
25286671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University