View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16879_low_8 (Length: 222)
Name: NF16879_low_8
Description: NF16879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16879_low_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 183; Significance: 4e-99; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 22 - 212
Target Start/End: Original strand, 44635866 - 44636056
Alignment:
| Q |
22 |
gctatgcctgcagtgaggatgacggaagaggcgacattggcgccagagagaccggcagcaagagcgaatggaacagtgagtccgtcagaggcaccgataa |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44635866 |
gctatgcctgcagtgaggatgacggaagaggcaacattggcgccagagagaccggcagcaagagcgaatggaacagtgagtccgtcagaggcaccgataa |
44635965 |
T |
|
| Q |
122 |
tgatgtcacggactatgtcaccggcggtgaaatgctcctcggtgtggttattgagaaggatctgtttctcaggttcaagggttagtctgtg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44635966 |
tgatgtcacggactatgtcaccggcggtgaaatgctcctcagtgtggttattgagaaggatctgtttctcaggttcaagggttagtctgtg |
44636056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 25 - 212
Target Start/End: Original strand, 44624620 - 44624807
Alignment:
| Q |
25 |
atgcctgcagtgaggatgacggaagaggcgacattggcgccagagagaccggcagcaagagcgaatggaacagtgagtccgtcagaggcaccgataatga |
124 |
Q |
| |
|
||||| |||||||||| || |||||| | |||||||||||||||||||||| || || ||||| || || ||||| || || || | || || |||| |
|
|
| T |
44624620 |
atgccagcagtgaggacgatggaagaagtagcattggcgccagagagaccggcggcgagggcgaaagggacggtgaggccatcggaaacgccaatgatga |
44624719 |
T |
|
| Q |
125 |
tgtcacggactatgtcaccggcggtgaaatgctcctcggtgtggttattgagaaggatctgtttctcaggttcaagggttagtctgtg |
212 |
Q |
| |
|
|||||||||| || ||||| |||||||| |||| || |||||| |||||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
44624720 |
tgtcacggacgatttcacccgcggtgaagtgcttttcagtgtggcgattgagaaggctctgtttctcaggttcaaggtttagtctgtg |
44624807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University