View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1687_high_25 (Length: 416)
Name: NF1687_high_25
Description: NF1687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1687_high_25 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 99; Significance: 1e-48; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 18 - 179
Target Start/End: Complemental strand, 43017299 - 43017130
Alignment:
| Q |
18 |
gagagagctcttttctcactttccacatgtatttggatgagtaaattcttaaaagtcacgatcttttgtcttgtaaatgaacaaaaccgaacaaatacta |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43017299 |
gagagagctcttttctcactttccacatgtatttggatgagtaaattctaaaaagtcacgatcttttgtcttgtaaatgaacaaaaccgaacaaatacta |
43017200 |
T |
 |
| Q |
118 |
--------nnnnnnnnnnactggaaagaacaggttgtgaatttaaagaaatcatggagtaaaagtagttc |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
43017199 |
ttttttttttttttttttactggaaagaacaggttgtgaatttaaagaaatcatgaagtaaaaatagttc |
43017130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 251 - 321
Target Start/End: Complemental strand, 43017127 - 43017057
Alignment:
| Q |
251 |
tttttaaggatctatcacaacgattcaggtctcacatcaagtatattgaggattctacaaccacaatgtca |
321 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43017127 |
tttttaaggatctatcacaacgattcaggtctcacatcaagtatattgatgattctacaaccacaatgtca |
43017057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University