View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1687_high_53 (Length: 256)
Name: NF1687_high_53
Description: NF1687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1687_high_53 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 19 - 246
Target Start/End: Original strand, 43817880 - 43818107
Alignment:
| Q |
19 |
ataatcttcattagtttgaaataatattatcaatggtttgttgttcttactgtttgcgtgtggttgctagtgtgtgataatacctgctgttctagtttgg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
43817880 |
ataatcttcattagtttgaaataatattatcaatggtttgttgttcttactgtttgcgtgtggttgctggtgtgtgataatacctgctgttctggtttgg |
43817979 |
T |
 |
| Q |
119 |
tgtgcacagctggagcgtgtagggggctgtttttgaggctttggaatgctcggctgggattagttgggatttttgtggtatgatagtgcatagaggctgt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
43817980 |
tgtgcacagctggagcgtgtagggggctgtttttgaggctttggaatgctcggctgggattagttgggatttttgtgggatgacagtgcatagaggctgt |
43818079 |
T |
 |
| Q |
219 |
tattagctaatgttctctaattcctttg |
246 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
43818080 |
tattagctaatgttctctaattcctttg |
43818107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 102 - 183
Target Start/End: Original strand, 19873246 - 19873327
Alignment:
| Q |
102 |
ctgctgttctagtttggtgtgcacagctggagcgtgtagggggctgtttttgaggctttggaatgctcggctgggattagtt |
183 |
Q |
| |
|
|||| ||||| || ||||| ||||| ||||| || |||||||||||| |||||||||| |||||||||||||| ||||| |
|
|
| T |
19873246 |
ctgcagttctggtgtggtgcgcacaattggagtgtttagggggctgttagcgaggctttggtatgctcggctgggactagtt |
19873327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University