View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1687_high_72 (Length: 219)
Name: NF1687_high_72
Description: NF1687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1687_high_72 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 102; Significance: 8e-51; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 18 - 135
Target Start/End: Original strand, 4616225 - 4616342
Alignment:
| Q |
18 |
taaaacatgtgcaagcccgtgttatgattttagtagaattattataaaattaactgttgttaaagaaatggataatgttgatgaatgtcatgagacttgc |
117 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
4616225 |
taaaacatgtgcaagcccttgttatgattttagtagaattattataaaattaactgttcttaaagaaatggataatgttgatgaatgtcatgaaacttgc |
4616324 |
T |
|
| Q |
118 |
cgtcacgaattcatttaa |
135 |
Q |
| |
|
||||||||||| |||||| |
|
|
| T |
4616325 |
cgtcacgaattgatttaa |
4616342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 141 - 208
Target Start/End: Original strand, 4616308 - 4616375
Alignment:
| Q |
141 |
aatgtcatgaaacttgccgtcacgaattgatttaacactaataattgtgattggctatttatcatatt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4616308 |
aatgtcatgaaacttgccgtcacgaattgatttaacactaataattgtgattggctatttatcatatt |
4616375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University